circad | circRNAs associated with diseases

Chr16:30740286-30740893\|+
Gene	SRCAP	Organism	Human
Genome Locus	chr16:30740286-30740893:+	Build	hg19
Disease	Gastric Cancer	ICD-10	Stomach, Malignant neoplasm of unspecified (C16.9)
DBLink	Link to database	PMID	28974900
Experimental Method
Sample Type	Colorectal Tissues	Comparison	60 GC tissues and paired adjacent non-tumor tissues, as well as 60 plasma samples from GC patients and 60 plasma samples from healthy controls
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CCTTTGCACCGTATTGTGTG Reverse GGCAGGGTACAGAAATCCAG	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Huang, M, He, YR, Liang, LC, Huang, Q, Zhu, ZQ (2017). Circular RNA hsa_circ_0000745 may serve as a diagnostic marker for gastric cancer. World J. Gastroenterol., 23, 34:6330-6338.